Быстрый заказ

Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CTSC Информация о продукте «Клон cDNA»
Размер кДНК:1392bp
Описание кДНК:Full length Clone DNA of Homo sapiens cathepsin C with C terminal HA tag.
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10484-ACGRBS15400
Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10484-ACRRBS15400
Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10484-CFRBS13340
Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10484-CHRBS13340
Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10484-CMRBS13340
Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10484-CYRBS13340
Человек Cathepsin C/CTSC Джин клон кДНК в вектор клонированияHG10484-GRBS5130
Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10484-NFRBS13340
Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10484-NHRBS13340
Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10484-NMRBS13340
Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10484-NYRBS13340
Человек Cathepsin C/CTSC Джин ORF экспрессии кДНК клона плазмидыHG10484-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cathepsins are proteases found in many types of cells conserved in all animals, which have a vital role in mammalian cellular turnover such as bone resorption. The lysosomal cysteine protease Cathepsin C (CTSC), also known as dipeptidyl peptidase I (DPPI/DPP1), activates a number of granule-associated serine proteases with pro-inflammatory and immune functions by removal of their inhibitory N-terminal dipeptides. This lysosomal exo-cysteine protease belonging to the peptidase C1 family. Active cathepsin C is found in lysosomes as a 200-kDa multimeric enzyme. Subunits constituting this assembly all arise from the proteolytic cleavage of a single precursor giving rise to three peptides: the propeptide, the alpha- and the beta-chains. It is a central coordinator for activation of many serine proteases in immune/inflammatory cells. Defects in the Cathepsin C have been shown to be a cause of Papillon-Lefevre disease, an autosomal recessive disorder characterized by palmoplantar keratosis and periodontitis. Cathepsin C plays a key role in the activation of several degradative enzymes linked to tissue destruction in inflammatory diseases. Thus, it is a therapeutic target for the treatment of a number of inflammatory and autoimmune diseases.

  • Santilman V, et al. (2002) Importance of the propeptide in the biosynthetic maturation of rat cathepsin C. Eur J Cell Biol. 81(12): 654-63.
  • Kam CM, et al. (2004) Design and evaluation of inhibitors for dipeptidyl peptidase I (Cathepsin C). Arch Biochem Biophys. 427(2): 123-34.
  • Noack B, et al. (2008) Cathepsin C gene variants in aggressive periodontitis. J Dent Res. 87(10): 958-63.
  • Laine DI, et al. (2010) Inhibitors of cathepsin C (dipeptidyl peptidase I). Expert Opin Ther Pat. 20(4): 497-506.
  • Size / Price
    Каталог: HG10484-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.