Быстрый заказ

Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек CTRL Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC063475
Размер кДНК:795bp
Описание кДНК:Full length Clone DNA of Homo sapiens chymotrypsin-like with N terminal Myc tag.
Синоним гена:CTRL1, MGC70821, CTRL
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CTRL qPCR primers for gene expression analysis, HP102425 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13748-ACGRBS15400
Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13748-ACRRBS15400
Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13748-CFRBS13340
Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13748-CHRBS13340
Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13748-CMRBS13340
Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13748-CYRBS13340
Человек CTRL-1 / Chymotrypsin-like protease Джин клон кДНК в вектор клонированияHG13748-GRBS5130
Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13748-NFRBS13340
Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13748-NHRBS13340
Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13748-NMRBS13340
Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13748-NYRBS13340
Человек CTRL-1 / Chymotrypsin-like protease Джин ORF экспрессии кДНК клона плазмидыHG13748-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CTRL-1, also known as chymotrypsin-like protease, belongs to the peptidase S1 family. CTRL-1 contains 1 peptidase S1 domain. Its expression is increased in preeclampsia (PE). Placental-derived chymotrypsin-like protease is responsible for inducing endothelial inflammatory phenotypic changes possibly by upregulation of cell adhesion molecule expressions, activation of cellular protease, and induction of extracellular regulated kinase phosphorylation. Activated microglia have been observed in various neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis, and multiple sclerosis. Five structurally distinct inhibitors that are known to inhibit chymotrypsin-like proteases were partially protective. They might represent a novel class of drugs with benefit in diseases where overactivity of microglia contributes to the pathogenesis.

Ссылки
  • Yang Gu. et al., 2009, Reprod Sci. 16 (9): 905-13.
  • Klegeris A. et al., 2005, Glia. 51 (1):56-64.
  • Caroline V. Bamford. et al., 2007, nfect Immun. 75 (9): 4364-72.
  • Size / Price
    Каталог: HG13748-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».