Быстрый заказ

Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек CTRC Информация о продукте «Клон cDNA»
Размер кДНК:807bp
Описание кДНК:Full length Clone DNA of Homo sapiens chymotrypsin C (caldecrin) with N terminal Myc tag.
Синоним гена:CLCR, ELA4, CTRC
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
( We provide with CTRC qPCR primers for gene expression analysis, HP101333 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11456-ACGRBS15400
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11456-ACRRBS15400
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11456-ANGRBS15400
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11456-ANRRBS15400
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11456-CFRBS13340
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11456-CHRBS13340
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11456-CMRBS13340
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11456-CYRBS13340
Человек CTRC Gene cDNA clone plasmidHG11456-MRBS5130
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11456-NFRBS13340
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11456-NHRBS13340
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11456-NMRBS13340
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11456-NYRBS13340
Человек CTRC/chymotrypsin C Джин ORF экспрессии кДНК клона плазмидыHG11456-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Chymotrypsin C (abbreviated for CTRC), also known as caldecrin or elastase4, is a digestive enzyme of the peptidase S1 family. This enzyme is synthesized as an inactivate chymotrypsinogen. On cleavage by trypsin into two parts that activate each other by removing two small peptides in a trans-proteolysis, chymotrypsin C produced. N-linked glycosylation of human CTRC is required for efficient folding and secretion, however, the N-linked glycan is unimportant for enzyme activity or inhibitor binding. It has been proposed that CTRC is a key regulator of digestive zymogen activation and a physiological co-activator of digestive carboxypeptidases proCPA1 and proCPA2. Mutations that abolish activity or secretion of CTRC increase the risk for chronic pancreatitis. It's speculated that CTRC might regulate pancreatic cancer cell migration in relation to cytokeratin 18 expression. The pancreatic cancer cell migration ability was downregulated in pancreatic cancer Aspc-1 cells that overexpressed CTRC, whereas the cell migration ability was upregulated in Aspc-1 cells in which CTRC was suppressed. 

  • Lacruz RS, et al. (2011) Chymotrypsin C (caldecrin) is associated with enamel development. J Dent Res. 90 (10): 1228-33.
  • Zhou J, et al. (2011) Chymotrypsin C mutations in chronic pancreatitis. J Gastroenterol Hepatol. 26 (8): 1238-46.
  • Wang H, et al. (2011) Effect of chymotrypsin C and related proteins on pancreatic cancer cell migration. Acta Biochim Biophys Sin (Shanghai). 43 (5): 362-71.
  • Size / Price
    Каталог: HG11456-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.