Быстрый заказ

Text Size:AAA

Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CTLA4 Информация о продукте «Клон cDNA»
Размер кДНК:654bp
Описание кДНК:Full length Clone DNA of Homo sapiens cytotoxic T-lymphocyte-associated protein 4, transcript variant 1 with N terminal HA tag.
Синоним гена:GSE, CD152, CTLA-4, IDDM12, CELIAC3, CTLA4
Участок рестрикции:KpnI + XbaI (6kb + 0.66kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CTLA4 Gene Plasmid Map
Human CTLA4 transcript variant 1 natural ORF mammalian expression plasmid, N-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11159-ACGRBS15396
Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11159-ACRRBS15396
Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11159-CFRBS13343
Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11159-CHRBS13343
Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11159-CMRBS13343
Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11159-CYRBS13343
Человек CTLA-4/CD152 transcript variant 1 Джин клон кДНК в вектор клонированияHG11159-GRBS5132
Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11159-NFRBS13343
Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11159-NHRBS13343
Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11159-NMRBS13343
Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11159-NYRBS13343
Человек CTLA-4/CD152 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG11159-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein and a member of the immunoglobulin superfamily. It is the second member of the CD28 receptor family. The ligands or counterreceptors for these two proteins are the B7 family members, CD80 (B7-1) and CD86 (B7-2). CTLA4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA4 is also found in regulatory T cells and may play an important role in their functions. CD152 or cytotoxic T lymphocyte antigen-4 (CTLA-4) is an essential receptor involved in the negative regulation of T cell activation. Because of its profound inhibitory role, CD152 has been considered a sound susceptible candidate in autoimmunity and a persuasive target for cancer immunotherapy. In particular, recent evidence suggests that CD152 is also important in the homeostasis and function of a population of suppressive cells, termed regulatory T cells (Treg).

  • Slavik JM, et al. (1999) CD28/CTLA-4 and CD80/CD86 families: signaling and function. Immunol Res. 19(1): 1-24.
  • Holmberg D, et al. (2005) CTLA-4 (CD152) and its involvement in autoimmune disease. Autoimmunity. 38(3): 225-33.
  • Chin LT, et al. (2008) Immune intervention with monoclonal antibodies targeting CD152 (CTLA-4) for autoimmune and malignant diseases. Chang Gung Med J. 31(1): 1-15.
  • Size / Price
    Каталог: HG11159-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human CTLA4 transcript variant 1 natural ORF mammalian expression plasmid, N-HA tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.