Быстрый заказ

Text Size:AAA

Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CTHRC1 Информация о продукте «Клон cDNA»
Размер кДНК:732bp
Описание кДНК:Full length Clone DNA of Homo sapiens collagen triple helix repeat containing 1 with C terminal Flag tag.
Синоним гена:CTHRC1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11647-ACGRBS15400
Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11647-ACRRBS15400
Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11647-CFRBS13340
Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11647-CHRBS13340
Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11647-CMRBS13340
Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11647-CYRBS13340
Человек CTHRC1 Джин клон кДНК в вектор клонированияHG11647-MRBS5130
Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11647-NFRBS13340
Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11647-NHRBS13340
Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11647-NMRBS13340
Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11647-NYRBS13340
Человек CTHRC1 Джин ORF экспрессии кДНК клона плазмидыHG11647-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Collagen triple helix repeat-containing protein 1, also known as Protein NMTC1, and CTHRC1, is a secreted protein that is glycosylated and highly conserved from lower chordates to mammals. CTHRC1 expression was not detectable in normal arteries. However, it is transiently expressed in the arterial wall in response to injury where it may contribute to vascular remodeling by limiting collagen matrix deposition and promoting cell migration. A short collagen motif with 12 Gly-X-Y repeats appears to be responsible for trimerization of the CTHRC1 protein and this renders the molecule susceptible to cleavage by collagenase. CTHRC1 overexpression caused a dramatic reduction in collagen type I mRNA and protein levels. Currently available data indicate that Cthrc1 expression in vascular cells regulates transforming growth factor beta responsiveness, thereby impacting transforming growth factor beta target genes, including collagens. Additionally, CTHRC1 increases bone mass as a positive regulator of osteoblastic bone formation and offers an anabolic approach for the treatment of osteoporosis.

  • Pyagay P, et al. (2005) Collagen triple helix repeat containing 1, a novel secreted protein in injured and diseased arteries, inhibits collagen expression and promotes cell migration. Circ Res. 96(2): 261-8.
  • Durmus T, et al. (2006) Expression analysis of the novel gene collagen triple helix repeat containing-1 (Cthrc1). Gene Expr Patterns. 6(8): 935-40.
  • LeClair R, et al. (2007) The role of collagen triple helix repeat containing 1 in injured arteries, collagen expression, and transforming growth factor beta signaling. Trends Cardiovasc Med. 17(6): 202-5.
  • Kimura H, et al. (2008) Cthrc1 is a positive regulator of osteoblastic bone formation. PLoS One. 3(9): e3174.
  • Size / Price
    Каталог: HG11647-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.