Быстрый заказ

Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CTCFL Информация о продукте «Клон cDNA»
Размер кДНК:1992bp
Описание кДНК:Full length Clone DNA of Homo sapiens CCCTC-binding factor (zinc finger protein)-like with C terminal His tag.
Синоним гена:CT27, BORIS, CTCF-T, HMGB1L1, dJ579F20.2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15751-ACGRBS16760
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15751-ACRRBS16760
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15751-ANGRBS16760
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15751-ANRRBS16760
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15751-CFRBS14710
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15751-CHRBS14710
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15751-CMRBS14710
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15751-CYRBS14710
Человек CTCFL/BORIS Джин клон кДНК в вектор клонированияHG15751-GRBS5130
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15751-NFRBS14710
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15751-NHRBS14710
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15751-NMRBS14710
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15751-NYRBS14710
Человек CTCFL/BORIS Джин ORF экспрессии кДНК клона плазмидыHG15751-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15751-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.