Cystatin D cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

Cystatin D cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
429 bp
Description
Full length Clone DNA of Human cystatin D with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cystatin D cDNA ORF Clone, Human, N-HA tag: Alternative Names

CST5 cDNA ORF Clone, Human; MGC71922 cDNA ORF Clone, Human

Cystatin D Background Information

Cystatins are natural inhibitors of papain-like (family C1) and legumain-related (family C13) cysteine peptidases. The mammalian cystatin superfamily members are of three major types, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. As a member of type 2 cystatin, cystatin D is a single-domain protein and also has cysteine residues that form disulfide bridges. In contrast with the wider distribution of all the other family 2 cystatins, cystatin D is tissue-restricted expressed and has been found only in saliva and tears. and meanwhile, it displays an inhibition profile with a preferential inhibition on cathepsin S, H, L. Although the exact functions are largely unknown, it has reported that cystatin D is involved in the inhibition of virus replication and apoptosis.
Full Name
cystatin D
References
  • Freije J.P., et al.,(1991), Structure and expression of the gene encoding cystatin D, a novel human cysteine proteinase inhibitor. J. Biol. Chem. 266:20538-20543.
  • Freije J.P., et al., (1993), Human cystatin D. cDNA cloning, characterization of the Escherichia coli expressed inhibitor, and identification of the native protein in saliva.J. Biol. Chem. 268:15737-15744.
  • Deloukas P., et al.,(2001), The DNA sequence and comparative analysis of human chromosome 20.Nature 414:865-871.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait