Быстрый заказ

Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CST5 Информация о продукте «Клон cDNA»
Размер кДНК:429bp
Описание кДНК:Full length Clone DNA of Homo sapiens cystatin D with N terminal HA tag.
Синоним гена:CST5, MGC71922
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10506-ACGRBS15400
Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10506-ACRRBS15400
Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10506-CFRBS13340
Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10506-CHRBS13340
Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10506-CMRBS13340
Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10506-CYRBS13340
Человек Cystatin D / CST5 Джин клон кДНК в вектор клонированияHG10506-MRBS5130
Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10506-NFRBS13340
Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10506-NHRBS13340
Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10506-NMRBS13340
Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10506-NYRBS13340
Человек Cystatin D / CST5 Джин ORF экспрессии кДНК клона плазмидыHG10506-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cystatins are natural inhibitors of papain-like (family C1) and legumain-related (family C13) cysteine peptidases. The mammalian cystatin superfamily members are of three major types, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. As a member of type 2 cystatin, cystatin D is a single-domain protein and also has cysteine residues that form disulfide bridges. In contrast with the wider distribution of all the other family 2 cystatins, cystatin D is tissue-restricted expressed and has been found only in saliva and tears. and meanwhile, it displays an inhibition profile with a preferential inhibition on cathepsin S, H, L. Although the exact functions are largely unknown, it has reported that cystatin D is involved in the inhibition of virus replication and apoptosis.

Size / Price
Каталог: HG10506-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.