After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CSRP3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC005900
Размер кДНК:585bp
Описание кДНК:Full length Clone DNA of Homo sapiens cysteine and glycine-rich protein 3 (cardiac LIM protein) with C terminal His tag.
Синоним гена:CLP, MLP, CRP3, LMO4, CMD1M, CMH12, CSRP3
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14006-ACGRBS15400
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14006-ACRRBS15400
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14006-ANGRBS15400
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14006-ANRRBS15400
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14006-CFRBS13340
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14006-CHRBS13340
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14006-CMRBS13340
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14006-CYRBS13340
Человек CSRP3 Джин клон кДНК в вектор клонированияHG14006-GRBS5130
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14006-NFRBS13340
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14006-NHRBS13340
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14006-NMRBS13340
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14006-NYRBS13340
Человек CSRP3 Джин ORF экспрессии кДНК клона плазмидыHG14006-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14006-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».