After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CSNK1A1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001892.4
Размер кДНК:1014bp
Описание кДНК:Full length Clone DNA of Homo sapiens casein kinase 1, alpha 1.
Синоним гена:CK1, HLCDGP1, PRO2975, CSNK1A1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-CSNK1A1
Участок рестрикции:KpnI + XbaI (6.1kb + 1.01kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CSNK1A1 Gene Plasmid Map
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10668-ACGRBS15400
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10668-ACRRBS15400
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10668-ANGRBS15400
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10668-ANRRBS15400
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10668-CFRBS13340
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10668-CHRBS13340
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10668-CMRBS13340
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10668-CYRBS13340
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин клон кДНК в вектор клонированияHG10668-MRBS5130
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10668-M-FRBS13340
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10668-NFRBS13340
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10668-NHRBS13340
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10668-NMRBS13340
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10668-NYRBS13340
Человек CSNK1A1/Casein Kinase 1, alpha 1 Джин ORF экспрессии кДНК клона плазмидыHG10668-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.

Ссылки
  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
  • Size / Price
    Каталог: HG10668-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».