After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CSK Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001127190.1
Размер кДНК:1353bp
Описание кДНК:Full length Clone DNA of Homo sapiens c-src tyrosine kinase with N terminal His tag.
Синоним гена:MGC117393, CSK
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10740-ACGRBS15400
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10740-ACRRBS15400
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10740-ANGRBS15400
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10740-ANRRBS15400
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10740-CFRBS13340
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10740-CHRBS13340
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10740-CMRBS13340
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10740-CYRBS13340
Человек C-Src Kinase / CSK Джин клон кДНК в вектор клонированияHG10740-MRBS5130
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10740-NFRBS13340
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10740-NHRBS13340
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10740-NMRBS13340
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10740-NYRBS13340
Человек C-Src Kinase / CSK Джин ORF экспрессии кДНК клона плазмидыHG10740-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The tyrosine kinase c-Src has been implicated as a modulator of cell proliferation, spreading, and migration. These functions are also regulated by Met. The structure of a large fragment of the c-Src kinase comprises the regulatory and kinase domains and the carboxy-terminal tall. c-Src kinase interactions among domains and is stabilized by binding of the phosphorylated tail to the SH2 domain. This molecule is locked in a conformation that simultaneously disrupts the kinase active site and sequesters the binding surfaces of the SH2 and SH3 domains. The structure shows how appropriate cellular signals, or transforming mutations in v-Src, could break these interactions to produce an open, active kinase. The protein-tyrosine kinase activity of c-Src kinase is inhibited by phosphorylation of tyr527, within the c-Src c-terminal tail. Genetic and biochemical data have suggested that this negative regulation requires an intact Src homology 2 (SH2) domain. Since SH2 domains recognize phosphotyrosine, it is possible that these two non-catalytic domains associate, and thereby repress c-Src kinase activity. Experiments have suggested that c-Src kinase plays a role in the biological behaviour of colonic carcinoma cells induced by migratory factors such as EGF, perhaps acting in conjunction with FAK to regulate focal adhesion turnover and tumour cell motility. Furthermore, although c-Src kinase has been implicated in colonic tumour progression, in the adenoma to carcinoma in vitro model c-Src is not the driving force for this progression but co-operates with other molecules in carcinoma development.

References

Ссылки
  • Brauninger A. et al.,1992, Gene. 110: 205-11.
  • Sondhi D. et al., 1999, Biochemistry. 38 (34): 11147-55.
  • Ogawa A. et al., 2002, J Biol Chem. 277 (17): 14351-4.
  • Cole PA. et al., 2003, Curr Opin Chem Biol. 7 (5): 580-5.
  • Baumeister U. et al., 2005,EMBO J. 24 (9): 1686-95.
  • Size / Price
    Каталог: HG10740-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».