Быстрый заказ

Человек CSH2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CSH2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC022044
    Размер кДНК:654bp
    Описание кДНК:Full length Clone DNA of Homo sapiens chorionic somatomammotropin hormone 2.
    Синоним гена:CSB, CS-2, hCS-B, CSH2
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CSH2 qPCR primers for gene expression analysis, HP102008 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек CSH2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек CSH2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13300-ACGRBS15400
    Человек CSH2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13300-ACRRBS15400
    Человек CSH2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13300-CFRBS13340
    Человек CSH2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13300-CHRBS13340
    Человек CSH2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13300-CMRBS13340
    Человек CSH2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13300-CYRBS13340
    Человек CSH2 Джин клон кДНК в вектор клонированияHG13300-GRBS5130
    Человек CSH2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13300-NFRBS13340
    Человек CSH2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13300-NHRBS13340
    Человек CSH2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13300-NMRBS13340
    Человек CSH2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13300-NYRBS13340
    Человек CSH2 Джин ORF экспрессии кДНК клона плазмидыHG13300-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13300-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».