After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CSDE1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001242892.1
Размер кДНК:2397bp
Описание кДНК:Full length Clone DNA of Homo sapiens cold shock domain containing E1, RNA-binding.
Синоним гена:UNR, D1S155E, RP5-1000E10.3
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16149-ACGRBS16760
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16149-ACRRBS16760
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16149-ANGRBS16760
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16149-ANRRBS16760
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16149-CFRBS14710
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16149-CHRBS14710
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16149-CMRBS14710
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16149-CYRBS14710
Человек CSDE1 Джин клон кДНК в вектор клонированияHG16149-GRBS5130
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16149-NFRBS14710
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16149-NHRBS14710
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16149-NMRBS14710
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16149-NYRBS14710
Человек CSDE1 Джин ORF экспрессии кДНК клона плазмидыHG16149-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16149-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».