Быстрый заказ

Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

  • other Green fluorescent protein / GFP Gene Plasmid Map 5611
ПаспортОбзорыСвязанные продуктыПротоколы
Человек CRP Информация о продукте «Клон cDNA»
Размер кДНК:720 bp
Описание кДНК:Full length Clone DNA of Homo sapiens C-reactive protein, pentraxin-related with C terminal Myc tag.
Синоним гена:PTX1, MGC88244, MGC149895, CRP
Участок рестрикции:KpnI + XbaI(6kb+0.72kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with CRP qPCR primers for gene expression analysis, HP101134 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11250-ACGRBS15400
Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11250-ACRRBS15400
Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11250-CFRBS13340
Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11250-CHRBS13340
Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11250-CMRBS13340
Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11250-CYRBS13340
Человек C-Reactive Белок/CRP Джин клон кДНК в вектор клонированияHG11250-MRBS5130
Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмидыHG11250-M-NRBS13340
Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11250-NFRBS13340
Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11250-NHRBS13340
Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11250-NMRBS13340
Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11250-NYRBS13340
Человек C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмидыHG11250-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

C-reactive protein (CRP) is synthesized by the liver in response to factors released by fat cells. It is a member of the pentraxin family of proteins. The levels of CRP rise in response to inflammation. Human C-reactive protein (CRP) is the classical acute phase reactant, the circulating concentration of which rises rapidly and extensively in a cytokine-mediated response to tissue injury, infection and inflammation. Serum CRP values are routinely measured, empirically, to detect and monitor many human diseases. However, CRP is likely to have important host defence, scavenging and metabolic functions through its capacity for calcium-dependent binding to exogenous and autologous molecules containing phosphocholine (PC) and then activating the classical complement pathway. CRP may also have pathogenic effects and the recent discovery of a prognostic association between increased CRP production and coronary atherothrombotic events is of particular interest.

  • Pepys MB. et al., 2003, J Clin Invest. 111 (12): 1805-12.
  • Thompson D. et al., 1999, Structure. 7(2): 169-77.
  • Size / Price
    Каталог: HG11250-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Добавить в корзинуЗапрос по оптовому заказу

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.