Быстрый заказ

Text Size:AAA

Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CRIPT Информация о продукте «Клон cDNA»
Размер кДНК:306bp
Описание кДНК:Full length Clone DNA of Homo sapiens cysteine-rich PDZ-binding protein with N terminal Flag tag.
Синоним гена:HSPC139
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14560-ACGRBS15400
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14560-ACRRBS15400
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14560-ANGRBS15400
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14560-ANRRBS15400
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14560-CFRBS13340
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14560-CHRBS13340
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14560-CMRBS13340
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14560-CYRBS13340
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин клон кДНК в вектор клонированияHG14560-GRBS5130
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14560-NFRBS13340
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14560-NHRBS13340
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14560-NMRBS13340
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14560-NYRBS13340
Человек CRIPT / cysteine-rich PDZ-binding Белок Джин ORF экспрессии кДНК клона плазмидыHG14560-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CRIPT, also known as cysteine-rich PDZ-binding protein, belongs to the CRIPT family. It interacts with TUBB1. CRIPT also interacts strongly with the PDZ3 domain of members of the DLG4 family. It is involved in the cytoskeletal anchoring of DLG4 in excitatory synapses. CRIPT is highly conserved from mammals to plants and binds selectively to the third PDZ domain (PDZ3) of PSD-95 via its C terminus. n heterologous cells, CRIPT causes a redistribution of PSD-95 to microtubules. In brain, CRIPT colocalizes with PSD-95 in the postsynaptic density and can be coimmunoprecipitated with PSD-95 and tubulin. These findings suggest that CRIPT may regulate PSD-95 interaction with a tubulin-based cytoskeleton in excitatory synapses.

  • Niethammer M. et al., 1998,Neuron. 20 (4): 693-707.
  • Passafaro M. et al., 2000, Nat Neurosci. 2 (12): 1063-9.
  • Piserchio A. et al., 2002, J Biol Chem. 277 (9): 6967-73.
  • Fukunaga Y. et al., 2005, J Biochem. 138 (2): 177-82.
  • Size / Price
    Каталог: HG14560-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.