Быстрый заказ

Text Size:AAA

Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CRELD1 Информация о продукте «Клон cDNA»
Размер кДНК:1263bp
Описание кДНК:Full length Clone DNA of Homo sapiens cysteine-rich with EGF-like domains 1 with C terminal His tag.
Синоним гена:AVSD2, CIRRIN, CRELD1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13411-ACGRBS15400
Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13411-ACRRBS15400
Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13411-CFRBS13340
Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13411-CHRBS13340
Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13411-CMRBS13340
Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13411-CYRBS13340
Человек CRELD1 Джин клон кДНК в вектор клонированияHG13411-GRBS5130
Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13411-NFRBS13340
Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13411-NHRBS13340
Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13411-NMRBS13340
Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13411-NYRBS13340
Человек CRELD1 Джин ORF экспрессии кДНК клона плазмидыHG13411-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CRELD1 is a transmembrane glycoprotein. Epidermal growth factor(EGF)­like domain exists in CRELD1. EGF-like repeats are a class of cysteine-rich domains that mediate interactions between proteins of diverse function. EGF domains are found in proteins that are either completely secreted or have transmembrane regions that tether the protein to the cell surface. CRELD1 contains a 333 amino acid acid (aa) extracellular domain (ECD), two tandem transmembrane segments, and a second ECD of 15 aa. Defects in CRELD1 may cause susceptibility to atrioventricular septal defect type 2 which results in a persistent common atrioventricular canal.

  • Robinson SW, et al. (2003) Missense Mutations in CRELD1 Are Associated with Cardiac Atrioventricular Septal Defects. Am J Hum Genet. 72(4):1047-52.
  • Zatyka M, et al. (2005) Analysis of CRELD1 as a candidate 3p25 atrioventicular septal defect locus (AVSD2). Clin Genet. 67(6):526-8.
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.