Быстрый заказ

Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CRELD1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_015513.4
    Размер кДНК:1263bp
    Описание кДНК:Full length Clone DNA of Homo sapiens cysteine-rich with EGF-like domains 1 with C terminal His tag.
    Синоним гена:AVSD2, CIRRIN, CRELD1
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CRELD1 qPCR primers for gene expression analysis, HP102113 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13411-ACGRBS15400
    Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13411-ACRRBS15400
    Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13411-CFRBS13340
    Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13411-CHRBS13340
    Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13411-CMRBS13340
    Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13411-CYRBS13340
    Человек CRELD1 Джин клон кДНК в вектор клонированияHG13411-GRBS5130
    Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13411-NFRBS13340
    Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13411-NHRBS13340
    Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13411-NMRBS13340
    Человек CRELD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13411-NYRBS13340
    Человек CRELD1 Джин ORF экспрессии кДНК клона плазмидыHG13411-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    CRELD1 is a transmembrane glycoprotein. Epidermal growth factor(EGF)­like domain exists in CRELD1. EGF-like repeats are a class of cysteine-rich domains that mediate interactions between proteins of diverse function. EGF domains are found in proteins that are either completely secreted or have transmembrane regions that tether the protein to the cell surface. CRELD1 contains a 333 amino acid acid (aa) extracellular domain (ECD), two tandem transmembrane segments, and a second ECD of 15 aa. Defects in CRELD1 may cause susceptibility to atrioventricular septal defect type 2 which results in a persistent common atrioventricular canal.

    Ссылки
  • Robinson SW, et al. (2003) Missense Mutations in CRELD1 Are Associated with Cardiac Atrioventricular Septal Defects. Am J Hum Genet. 72(4):1047-52.
  • Zatyka M, et al. (2005) Analysis of CRELD1 as a candidate 3p25 atrioventicular septal defect locus (AVSD2). Clin Genet. 67(6):526-8.
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Size / Price
    Каталог: HG13411-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».