Быстрый заказ

Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CREB3L4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC038962
Размер кДНК:1188bp
Описание кДНК:Full length Clone DNA of Homo sapiens cAMP responsive element binding protein 3-like 4 with C terminal His tag.
Синоним гена:JAL, hJAL, ATCE1, CREB3, CREB4, AIBZIP
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15174-ACGRBS15400
Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15174-ACRRBS15400
Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15174-CFRBS13340
Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15174-CHRBS13340
Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15174-CMRBS13340
Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15174-CYRBS13340
Человек CREB3L4/AIBZIP Джин клон кДНК в вектор клонированияHG15174-GRBS5130
Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15174-NFRBS13340
Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15174-NHRBS13340
Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15174-NMRBS13340
Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15174-NYRBS13340
Человек CREB3L4/AIBZIP Джин ORF экспрессии кДНК клона плазмидыHG15174-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15174-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».