After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CREB3L2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC063666
Размер кДНК:744bp
Описание кДНК:Full length Clone DNA of Homo sapiens cAMP responsive element binding protein 3-like 2 DNA.
Синоним гена:BBF2H7
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15245-ACGRBS15400
Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15245-ACRRBS15400
Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15245-CFRBS13340
Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15245-CHRBS13340
Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15245-CMRBS13340
Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15245-CYRBS13340
Человек CREB3L2 Джин клон кДНК в вектор клонированияHG15245-GRBS5130
Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15245-NFRBS13340
Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15245-NHRBS13340
Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15245-NMRBS13340
Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15245-NYRBS13340
Человек CREB3L2 Джин ORF экспрессии кДНК клона плазмидыHG15245-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15245-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».