Быстрый заказ

Text Size:AAA

Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CPZ Информация о продукте «Клон cDNA»
Размер кДНК:1548bp
Описание кДНК:Full length Clone DNA of Homo sapiens carboxypeptidaseZ with C terminal HA tag.
Синоним гена:CPZ
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13430-ACGRBS16764
Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13430-ACRRBS16764
Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13430-CFRBS14711
Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13430-CHRBS14711
Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13430-CMRBS14711
Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13430-CYRBS14711
Человек CPZ/carboxypeptidase Z Джин клон кДНК в вектор клонированияHG13430-GRBS5132
Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13430-NFRBS14711
Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13430-NHRBS14711
Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13430-NMRBS14711
Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13430-NYRBS14711
Человек CPZ/carboxypeptidase Z Джин ORF экспрессии кДНК клона плазмидыHG13430-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13430-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.