CPSF3/CPSF73 cDNA ORF Clone, Human, untagged

Cat: HG11480-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CPSF3/CPSF73 Reagents

CRO Services

Product recommended


All CPSF3/CPSF73 Reagents

CPSF3/CPSF73 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2055 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cleavage and polyadenylation specific factor 3, 73kDa.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + PmeI (6.1kb + 2.06kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CPSF3/CPSF73 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CPSF3/CPSF73 cDNA ORF Clone, Human, untagged Validated Images

Human BubR1/BUB1B Gene Plasmid Map 7331

CPSF3/CPSF73 cDNA ORF Clone, Human, untagged Alternative Names

CPSF-73 cDNA ORF Clone, Human;CPSF73 cDNA ORF Clone, Human

CPSF3/CPSF73 Background Information

Full Name
cleavage and polyadenylation specific factor 3, 73kDa

CPSF3/CPSF73 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CPSF3/CPSF73 cDNA ORF Clone in Cloning Vector, Mouse MG5A4704-U
CPSF3/CPSF73 cDNA ORF Clone, Mouse, untagged MG5A4704-UT
CPSF3/CPSF73 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4704-ACGLN
CPSF3/CPSF73 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4704-ACG
CPSF3/CPSF73 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4704-ANG
CPSF3/CPSF73 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4704-ACR
CPSF3/CPSF73 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4704-ANR
CPSF3/CPSF73 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4704-CF
CPSF3/CPSF73 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4704-NF
CPSF3/CPSF73 cDNA ORF Clone, Mouse, C-His tag MG5A4704-CH
CPSF3/CPSF73 cDNA ORF Clone, Mouse, N-His tag MG5A4704-NH
CPSF3/CPSF73 cDNA ORF Clone, Mouse, C-HA tag MG5A4704-CY
CPSF3/CPSF73 cDNA ORF Clone, Mouse, N-HA tag MG5A4704-NY
CPSF3/CPSF73 cDNA ORF Clone, Mouse, C-Myc tag MG5A4704-CM
CPSF3/CPSF73 cDNA ORF Clone, Mouse, N-Myc tag MG5A4704-NM

CPSF3/CPSF73 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CPSF3/CPSF73 cDNA ORF Clone in Cloning Vector, Human HG11480-M
CPSF3/CPSF73 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11480-ACGLN
CPSF3/CPSF73 cDNA ORF Clone, Human, C-GFPSpark® tag HG11480-ACG
CPSF3/CPSF73 cDNA ORF Clone, Human, N-GFPSpark® tag HG11480-ANG
CPSF3/CPSF73 cDNA ORF Clone, Human, C-OFPSpark® tag HG11480-ACR
CPSF3/CPSF73 cDNA ORF Clone, Human, N-OFPSpark® tag HG11480-ANR
CPSF3/CPSF73 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11480-CF
CPSF3/CPSF73 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11480-NF
CPSF3/CPSF73 cDNA ORF Clone, Human, C-His tag HG11480-CH
CPSF3/CPSF73 cDNA ORF Clone, Human, N-His tag HG11480-NH
CPSF3/CPSF73 cDNA ORF Clone, Human, C-HA tag HG11480-CY
CPSF3/CPSF73 cDNA ORF Clone, Human, N-HA tag HG11480-NY
CPSF3/CPSF73 cDNA ORF Clone, Human, C-Myc tag HG11480-CM
CPSF3/CPSF73 cDNA ORF Clone, Human, N-Myc tag HG11480-NM
CPSF3/CPSF73 qPCR Primer Pairs, Human HP101356
info info
添加购物车成功! 添加购物车失败!