After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CPEB1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC050629
Размер кДНК:1686bp
Описание кДНК:Full length Clone DNA of Homo sapiens cytoplasmic polyadenylation element binding protein 1 DNA.
Синоним гена:CEBP, CPEB, CPE-BP1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15225-ACGRBS16760
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15225-ACRRBS16760
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15225-ANGRBS16760
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15225-ANRRBS16760
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15225-CFRBS14710
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15225-CHRBS14710
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15225-CMRBS14710
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15225-CYRBS14710
Человек CPEB1 Джин клон кДНК в вектор клонированияHG15225-GRBS5130
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15225-NFRBS14710
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15225-NHRBS14710
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15225-NMRBS14710
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15225-NYRBS14710
Человек CPEB1 Джин ORF экспрессии кДНК клона плазмидыHG15225-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15225-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».