Быстрый заказ

Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

  • other Green fluorescent protein / GFP Gene Plasmid Map 5612
ПаспортОбзорыСвязанные продуктыПротоколы
Человек CPB1 Информация о продукте «Клон cDNA»
Размер кДНК:1296 bp
Описание кДНК:Full length Clone DNA of Homo sapiens carboxypeptidase B1 (tissue) with C terminal HA tag.
Синоним гена:PASP, PCPB, DKFZp779K1333
Участок рестрикции:KpnI + XbaI(6kb+1.3kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with CPB1 qPCR primers for gene expression analysis, HP100522 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10501-ACGRBS15400
Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10501-ACRRBS15400
Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10501-CFRBS13340
Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10501-CHRBS13340
Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10501-CMRBS13340
Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10501-CYRBS13340
Человек Carboxypeptidase B1/CPB1 Джин клон кДНК в вектор клонированияHG10501-MRBS5130
Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10501-NFRBS13340
Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10501-NHRBS13340
Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10501-NMRBS13340
Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10501-NYRBS13340
Человек Carboxypeptidase B1/CPB1 Джин ORF экспрессии кДНК клона плазмидыHG10501-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Carboxypeptidase B1, also well known as pancreatic procarboxypeptidase B (PCPB), is a highly pancreas -specific protein (PASP), and has been identified previously as a serum marker for acute pancreatitis and pancreatic graft rejection. As the prototype for those human exopeptidases that cleave off basic C-terminal residues, CPB1 specifically cleaves the C-terminal Arg and Lys residues with a preference for Arg. The B1 and B2 forms of procarboxypeptidase B differ from each other mainly in isoelectric point.The deduced amino acid sequence of PCPB predicts a 416-amino acid preproenzyme consisting of a 15-aa signal peptide, a 95-aa activation peptide and a 307-aa mature chain. The secreted PCPB zymogen is converted to enzymatically active CPB1 by limited proteolysis by trypsin.

  • Yamamoto, K.K. et al., 1992, J. Biol. Chem. 267: 2575-2581.
  • Pezzilli, R. et al., 1994, Digestion. 55: 73-77.
  • Barbosa Pereira, P.J. et al., 2002, J. Mol. Biol. 321: 537-547.
  • Size / Price
    Каталог: HG10501-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Добавить в корзинуЗапрос по оптовому заказу

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.