Быстрый заказ

Text Size:AAA

Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CPA2 Информация о продукте «Клон cDNA»
Размер кДНК:1254bp
Описание кДНК:Full length Clone DNA of Homo sapiens carboxypeptidase A2 (pancreatic) with N terminal HA tag.
Синоним гена:CPA2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10499-ACGRBS15400
Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10499-ACRRBS15400
Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10499-CFRBS13340
Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10499-CHRBS13340
Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10499-CMRBS13340
Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10499-CYRBS13340
Человек Carboxypeptidase A2/CPA2 Джин клон кДНК в вектор клонированияHG10499-MRBS5130
Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10499-NFRBS13340
Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10499-NHRBS13340
Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10499-NMRBS13340
Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10499-NYRBS13340
Человек Carboxypeptidase A2/CPA2 Джин ORF экспрессии кДНК клона плазмидыHG10499-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Human Carboxypeptidase A2 ( CPA2 ) is a secreted pancreatic procarboxy -peptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group. The hydrolytic action of CPA2 was identified with a preference towards long substrates with aromatic amino acids in their C-terminal end, particularly tryptophan. CPA2 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. Three different forms of human pancreatic procarboxypeptidase A have been isolated, and the A1 and A2 forms are always secreted as monomeric proteins with different biochemical properties.

  • Catasus, L. et al., 1995. J. Biol. Chem. 270: 6651-6657.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Laethem, RM. et al., 1996, Arch. Biochem. Biophys.332: 8-18.
  • Size / Price
    Каталог: HG10499-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.