After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human COQ9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC064946
Размер кДНК:957bp
Описание кДНК:Full length Clone DNA of Homo sapiens coenzyme Q9 homolog (S. cerevisiae) DNA.
Синоним гена:COQ10D5, C16orf49
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15252-ACGRBS15400
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15252-ACRRBS15400
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15252-ANGRBS15400
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15252-ANRRBS15400
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15252-CFRBS13340
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15252-CHRBS13340
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15252-CMRBS13340
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15252-CYRBS13340
Человек COQ9 Джин клон кДНК в вектор клонированияHG15252-GRBS5130
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15252-NFRBS13340
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15252-NHRBS13340
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15252-NMRBS13340
Человек COQ9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15252-NYRBS13340
Человек COQ9 Джин ORF экспрессии кДНК клона плазмидыHG15252-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15252-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».