Быстрый заказ

Text Size:AAA

Человек COQ10B Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human COQ10B Информация о продукте «Клон cDNA»
Размер кДНК:717bp
Описание кДНК:Full length Clone DNA of Homo sapiens coenzyme Q10 homolog B (S. cerevisiae) with N terminal Myc tag.
Синоним гена:COQ10B
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек COQ10B Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек COQ10B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15461-ACGRBS15400
Человек COQ10B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15461-ACRRBS15400
Человек COQ10B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15461-CFRBS13340
Человек COQ10B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15461-CHRBS13340
Человек COQ10B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15461-CMRBS13340
Человек COQ10B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15461-CYRBS13340
Человек COQ10B Джин клон кДНК в вектор клонированияHG15461-GRBS5130
Человек COQ10B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15461-NFRBS13340
Человек COQ10B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15461-NHRBS13340
Человек COQ10B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15461-NMRBS13340
Человек COQ10B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15461-NYRBS13340
Человек COQ10B Джин ORF экспрессии кДНК клона плазмидыHG15461-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15461-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.