After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human COPS2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_004236.3
Размер кДНК:1332bp
Описание кДНК:Full length Clone DNA of Homo sapiens COP9 constitutive photomorphogenic homolog subunit 2 transcript variant 1 with N terminal His tag.
Синоним гена:CSN2, SGN2, ALIEN, TRIP15
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13676-ACGRBS15400
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13676-ACRRBS15400
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13676-ANGRBS15400
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13676-ANRRBS15400
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13676-CFRBS13340
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13676-CHRBS13340
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13676-CMRBS13340
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13676-CYRBS13340
Человек TRIP15/COPS2 transcript variant 1 Джин клон кДНК в вектор клонированияHG13676-GRBS5130
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13676-NFRBS13340
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13676-NHRBS13340
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13676-NMRBS13340
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13676-NYRBS13340
Человек TRIP15/COPS2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG13676-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13676-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».