After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек COMT Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human COMT Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000754
Размер кДНК:816bp
Описание кДНК:Full length Clone DNA of Homo sapiens catechol-O-methyltransferase.
Синоним гена:COMT
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек COMT Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12040-ACGRBS15400
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12040-ACRRBS15400
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12040-CFRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12040-CHRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12040-CMRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12040-CYRBS13340
Человек COMT Джин клон кДНК в вектор клонированияHG12040-GRBS5130
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12040-NFRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12040-NHRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12040-NMRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12040-NYRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмидыHG12040-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12040-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».