Быстрый заказ

Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human COMT Информация о продукте «Клон cDNA»
Размер кДНК:816bp
Описание кДНК:Full length Clone DNA of Homo sapiens catechol-O-methyltransferase with C terminal His tag.
Синоним гена:COMT
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12040-ACGRBS15400
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12040-ACRRBS15400
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12040-CFRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12040-CHRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12040-CMRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12040-CYRBS13340
Человек COMT Джин клон кДНК в вектор клонированияHG12040-GRBS5130
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12040-NFRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12040-NHRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12040-NMRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12040-NYRBS13340
Человек COMT Джин ORF экспрессии кДНК клона плазмидыHG12040-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12040-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.