Быстрый заказ

Text Size:AAA

Человек COMP Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human COMP Информация о продукте «Клон cDNA»
Размер кДНК:2274bp
Описание кДНК:Full length Clone DNA of Homo sapiens cartilage oligomeric matrix protein with N terminal Myc tag.
Синоним гена:COMP, MED, EDM1, EPD1, PSACH, THBS5, MGC131819, MGC149768
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек COMP Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек COMP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10173-ACGRBS16760
Человек COMP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10173-ACRRBS16760
Человек COMP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10173-CFRBS14710
Человек COMP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10173-CHRBS14710
Человек COMP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10173-CMRBS14710
Человек COMP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10173-CYRBS14710
Человек COMP Джин клон кДНК в вектор клонированияHG10173-MRBS5130
Человек COMP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10173-NFRBS14710
Человек COMP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10173-NHRBS14710
Человек COMP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10173-NMRBS14710
Человек COMP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10173-NYRBS14710
Человек COMP Джин ORF экспрессии кДНК клона плазмидыHG10173-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cartilage Oligomeric Matrix Protein (COMP), also referred to as Thrombospondin-5, is a non-collagenous extracellular matrix (ECM) protein and belongs to the subgroup B of the thrombospondin protein family. This protein is expressed primarily in cartilage, ligament, and tendon, and binds to other ECM proteins such as collagen I, II and IX with high affinities depending on the divalent cations Zn2+ or Ni2+. COMP is a secreted glycoprotein that is important for growth plate organization and function. It is suggested to play a role in cell growth and development, and recent studies have revealed the possible mechanism that it protects cells against death by elevating members of the IAP (inhibitor of apoptosis protein) family of survival proteins. Mutations in COMP cause two skeletal dysplasias, pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (EDM1), and up-regulated expression of COMP are observed in rheumatoid arthritis and certain carcinomas.

  • Posey KL, et al. (2004) Role of TSP-5/COMP in pseudoachondroplasia. Int J Biochem Cell Biol. 36(6): 1005-12.
  • Chen FH, et al. (2005) Interaction of cartilage oligomeric matrix protein/thrombospondin 5 with aggrecan. J Biol Chem. 282(34): 24591-8.
  • Posey KL, et al. (2008) The role of cartilage oligomeric matrix protein (COMP) in skeletal disease. Curr Drug Targets. 9(10): 869-77.
  • Tan K, et al. (2009) The crystal structure of the signature domain of cartilage oligomeric matrix protein: implications for collagen, glycosaminoglycan and integrin binding. FASEB J. 23(8): 2490-501.
  • Size / Price
    Каталог: HG10173-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.