Быстрый заказ

Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human COMMD9 Информация о продукте «Клон cDNA»
Размер кДНК:597bp
Описание кДНК:Full length Clone DNA of Homo sapiens COMM domain containing 9 with N terminal Flag tag.
Синоним гена:HSPC166
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14570-ACGRBS15396
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14570-ACRRBS15396
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14570-ANGRBS15396
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14570-ANRRBS15396
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14570-CFRBS13343
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14570-CHRBS13343
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14570-CMRBS13343
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14570-CYRBS13343
Человек COMMD9 Джин клон кДНК в вектор клонированияHG14570-GRBS5132
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14570-NFRBS13343
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14570-NHRBS13343
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14570-NMRBS13343
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14570-NYRBS13343
Человек COMMD9 Джин ORF экспрессии кДНК клона плазмидыHG14570-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

COMMD9 is a COMM domain-containing or COMMD protein. COMMD family is comprised of ten members which are widely conserved throughout evolution and share certain functional properties. They represent a recently discovered set of evolutionarily conserved factors characterized by the presence of a defining carboxy-terminal motif. COMMD protein functions in the control of the transcription factor NFkappaB. NFkappaB plays a critical role in a number of homeostatic processes in multicellular organisms, including the regulation of immunity and cell survival. COMMD proteins inhibit NFkappaB mediated gene expression, and recent mechanistic studies have revealed that COMMD1 controls the ubiquitination of NFkappaB subunits, an event linked to transcriptional termination. COMMD1 binds to a multimeric ubiquitin ligase containing Elongins B/C, Cul2 and SOCS1 (ECS( SOCS1)). In this complex, COMMD1 facilitates the binding of NFkappaB subunits to the ligase, thereby promoting their ubiquitination and degradation. Additional insights gained from these studies indicate that COMMD proteins likely play a broader role in cellular homeostasis through their participation in the ubiquitination pathway.

  • Ota T. et al., 2004, Nat Genet. 36 (1): 40-5.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Burstein E. et al., 2005, J Biol Chem. 280 (23): 22222-32.
  • Size / Price
    Каталог: HG14570-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.