Быстрый заказ

Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек COMMD9 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC010892
    Размер кДНК:597bp
    Описание кДНК:Full length Clone DNA of Homo sapiens COMM domain containing 9 with N terminal Flag tag.
    Синоним гена:HSPC166
    Виды:Human
    переносчик:pCMV3-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with COMMD9 qPCR primers for gene expression analysis, HP103209 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14570-ACGRBS15400
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14570-ACRRBS15400
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14570-ANGRBS15400
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14570-ANRRBS15400
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14570-CFRBS13340
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14570-CHRBS13340
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14570-CMRBS13340
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14570-CYRBS13340
    Человек COMMD9 Джин клон кДНК в вектор клонированияHG14570-GRBS5130
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14570-NFRBS13340
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14570-NHRBS13340
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14570-NMRBS13340
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14570-NYRBS13340
    Человек COMMD9 Джин ORF экспрессии кДНК клона плазмидыHG14570-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    COMMD9 is a COMM domain-containing or COMMD protein. COMMD family is comprised of ten members which are widely conserved throughout evolution and share certain functional properties. They represent a recently discovered set of evolutionarily conserved factors characterized by the presence of a defining carboxy-terminal motif. COMMD protein functions in the control of the transcription factor NFkappaB. NFkappaB plays a critical role in a number of homeostatic processes in multicellular organisms, including the regulation of immunity and cell survival. COMMD proteins inhibit NFkappaB mediated gene expression, and recent mechanistic studies have revealed that COMMD1 controls the ubiquitination of NFkappaB subunits, an event linked to transcriptional termination. COMMD1 binds to a multimeric ubiquitin ligase containing Elongins B/C, Cul2 and SOCS1 (ECS( SOCS1)). In this complex, COMMD1 facilitates the binding of NFkappaB subunits to the ligase, thereby promoting their ubiquitination and degradation. Additional insights gained from these studies indicate that COMMD proteins likely play a broader role in cellular homeostasis through their participation in the ubiquitination pathway.

    Ссылки
  • Ota T. et al., 2004, Nat Genet. 36 (1): 40-5.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Burstein E. et al., 2005, J Biol Chem. 280 (23): 22222-32.
  • Size / Price
    Каталог: HG14570-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».