After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human COL9A2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001852.3
Размер кДНК:2070bp
Описание кДНК:Full length Clone DNA of Homo sapiens collagen, type IX, alpha 2 with N terminal His tag.
Синоним гена:MED, EDM2, STL5, DJ39G22.4, COL9A2
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13680-ACGRBS16760
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13680-ACRRBS16760
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13680-CFRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13680-CHRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13680-CMRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13680-CYRBS14710
Человек COL9A2 Джин клон кДНК в вектор клонированияHG13680-GRBS5130
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13680-NFRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13680-NHRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13680-NMRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13680-NYRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмидыHG13680-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13680-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».