Быстрый заказ

Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек COL9A2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001852.3
Размер кДНК:2070bp
Описание кДНК:Full length Clone DNA of Homo sapiens collagen, type IX, alpha 2 with N terminal His tag.
Синоним гена:MED, EDM2, STL5, DJ39G22.4, COL9A2
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with COL9A2 qPCR primers for gene expression analysis, HP102359 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13680-ACGRBS16760
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13680-ACRRBS16760
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13680-CFRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13680-CHRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13680-CMRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13680-CYRBS14710
Человек COL9A2 Джин клон кДНК в вектор клонированияHG13680-GRBS5130
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13680-NFRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13680-NHRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13680-NMRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13680-NYRBS14710
Человек COL9A2 Джин ORF экспрессии кДНК клона плазмидыHG13680-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13680-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».