Быстрый заказ

Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек COL8A1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC013581
    Размер кДНК:2235bp
    Описание кДНК:Full length Clone DNA of Homo sapiens collagen, type VIII, alpha 1.
    Синоним гена:C3orf7, COL8A1
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with COL8A1 qPCR primers for gene expression analysis, HP101990 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13282-ACGRBS16760
    Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13282-ACRRBS16760
    Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13282-CFRBS14710
    Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13282-CHRBS14710
    Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13282-CMRBS14710
    Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13282-CYRBS14710
    Человек Collagen VIII alpha 1 Джин клон кДНК в вектор клонированияHG13282-GRBS5130
    Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13282-NFRBS14710
    Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13282-NHRBS14710
    Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13282-NMRBS14710
    Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13282-NYRBS14710
    Человек Collagen VIII alpha 1 Джин ORF экспрессии кДНК клона плазмидыHG13282-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13282-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».