Быстрый заказ

Человек COL5A2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human COL5A2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000393.3
Размер кДНК:4500bp
Описание кДНК:Full length Clone DNA of Homo sapiens collagen, type V, alpha 2 with N terminal His tag.
Синоним гена:COL5A2
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек COL5A2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек COL5A2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13685-ACGRBS25660
Человек COL5A2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13685-ACRRBS25660
Человек COL5A2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13685-CFRBS23610
Человек COL5A2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13685-CHRBS23610
Человек COL5A2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13685-CMRBS23610
Человек COL5A2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13685-CYRBS23610
Человек COL5A2 Джин клон кДНК в вектор клонированияHG13685-GRBS5130
Человек COL5A2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13685-NFRBS23610
Человек COL5A2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13685-NHRBS23610
Человек COL5A2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13685-NMRBS23610
Человек COL5A2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13685-NYRBS23610
Человек COL5A2 Джин ORF экспрессии кДНК клона плазмидыHG13685-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

COL5A2 is a component of type V collagen. It is known as the pro-alpha2(V) chain. COL5A2, together with two pro-alpha1(V) chains can form type V procollagen. These triple-stranded, rope-like procollagen molecules arrange themselves into long, thin fibrils that cross-link to one another in the spaces around cells. The cross-links result in the formation of very strong, mature type V collagen fibers. Type V collagen can be detected in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen.

Ссылки
  • Greenspan DS. et al., 1992, Genomics. 12 (4): 836-7.
  • Mann K. 1992, Biol Chem Hoppe-Seyler. 373 (2): 69-75.
  • Greenspan DS. et al., 1992, Gene Expr. 1 (1): 29-39.
  • Size / Price
    Каталог: HG13685-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».