COL4A3BP cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

COL4A3BP cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1797 bp
Description
Full length Clone DNA of Human collagen, type IV, alpha 3 (Goodpasture antigen) binding protein with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

COL4A3BP cDNA ORF Clone, Human, N-Myc tag: Alternative Names

CERT cDNA ORF Clone, Human; CERTL cDNA ORF Clone, Human; GPBP cDNA ORF Clone, Human; STARD11 cDNA ORF Clone, Human

COL4A3BP Background Information

COL4A3BP is a member of the StarD2 subfamily. It contains a pleckstrin homology domain at its amino terminus and a START domain towards the end of the molecule. COL4A3BP has a lipid-binding domain that mediates intracellular trafficking of ceramide in a non-vesicular manner. One isoform of COL4A3BP is also involved in ceramide intracellular transport. COL4A3BP specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. An autoimmune response directed at this antigen can cause goodpasture disease.
Full Name
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
References
  • Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Granero F, et al. (2005) A human-specific TNF-responsive promoter for Goodpasture antigen-binding protein. FEBS J. 272(20):5291-305.
  • Longo I, et al. (2006) Autosomal recessive Alport syndrome: an in-depth clinical and molecular analysis of five families. Nephrol Dial Transplant. 21(3):665-71.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait