Быстрый заказ

Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human COL4A3BP Информация о продукте «Клон cDNA»
Размер кДНК:1797bp
Описание кДНК:Full length Clone DNA of Homo sapiens collagen, type IV, alpha 3 (Goodpasture antigen) binding protein with N terminal Myc tag.
Синоним гена:CERT, CERTL, FLJ20597, GPBP, STARD11, COL4A3BP
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14306-ACGRBS16760
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14306-ACRRBS16760
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14306-ANGRBS16760
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14306-ANRRBS16760
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14306-CFRBS14710
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14306-CHRBS14710
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14306-CMRBS14710
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14306-CYRBS14710
Человек COL4A3BP Джин клон кДНК в вектор клонированияHG14306-GRBS5130
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14306-NFRBS14710
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14306-NHRBS14710
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14306-NMRBS14710
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14306-NYRBS14710
Человек COL4A3BP Джин ORF экспрессии кДНК клона плазмидыHG14306-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

COL4A3BP is a member of the StarD2 subfamily. It contains a pleckstrin homology domain at its amino terminus and a START domain towards the end of the molecule. COL4A3BP has a lipid-binding domain that mediates intracellular trafficking of ceramide in a non-vesicular manner. One isoform of COL4A3BP is also involved in ceramide intracellular transport. COL4A3BP specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. An autoimmune response directed at this antigen can cause goodpasture disease.

  • Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Granero F, et al. (2005) A human-specific TNF-responsive promoter for Goodpasture antigen-binding protein. FEBS J. 272(20):5291-305.
  • Longo I, et al. (2006) Autosomal recessive Alport syndrome: an in-depth clinical and molecular analysis of five families. Nephrol Dial Transplant. 21(3):665-71.
  • Size / Price
    Каталог: HG14306-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.