Быстрый заказ

Человек Cochlin Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human COCH Информация о продукте «Клон cDNA»
Размер кДНК:1653bp
Описание кДНК:Full length Clone DNA of Homo sapiens coagulation factor C homolog, cochlin (Limulus polyphemus) with N terminal His tag.
Синоним гена:DFNA9, COCH5B2, COCH-5B2, COCH
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Cochlin Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Cochlin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11368-ACGRBS16764
Человек Cochlin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11368-ACRRBS16764
Человек Cochlin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11368-CFRBS14711
Человек Cochlin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11368-CHRBS14711
Человек Cochlin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11368-CMRBS14711
Человек Cochlin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11368-CYRBS14711
Человек Cochlin Джин клон кДНК в вектор клонированияHG11368-MRBS5132
Человек Cochlin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11368-NFRBS14711
Человек Cochlin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11368-NHRBS14711
Человек Cochlin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11368-NMRBS14711
Человек Cochlin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11368-NYRBS14711
Человек Cochlin Джин ORF экспрессии кДНК клона плазмидыHG11368-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cochlin, also known as COCH-5B2 and COCH, is a secreted protein which contains one LCCL domain and two VWFA domains. It is an abundant inner ear protein expressed as multiple isoforms. Its function is also unknown, but it is suspected to be an extracellular matrix component. Cochlin and type II collagen are major constituents of the inner ear extracellular matrix, and Cochlin constitutes 70% of non-collagenous protein in the inner ear, the cochlin isoforms can be classified into three subgroups, p63s, p44s and p40s. The expression of cochlin is highly specific to the inner ear. Eleven missense mutation and one in-frame deletion have been reported in the COCH gene, causing hereditary progressive sensorineural hearing loss and vestibular dysfunction, deafness autosomal dominant type 9 (DFNA9). The co-localization of cochlin and type II collagen in the fibrillar substance in the subepithelial area indicate that cochlin may play a role in the structural homeostasis of the vestibule acting in concert with the fibrillar type II collagen bundles. Defects in COCH may contribute to Meniere disease which is an autosomal dominant disorder characterized by hearing loss associated with episodic vertigo.

  • Ikezono T, et al. (2005) Expression of cochlin in the vestibular organ of rats. ORL J Otorhinolaryngol Relat Spec. 67(5): 252-8.
  • Shindo S, et al. (2008) Spatiotemporal expression of cochlin in the inner ear of rats during postnatal development. Neurosci Lett. 444(2): 148-52.
  • Hosokawa S, et al. (2010) Ultrastructural localization of cochlin in the rat cochlear duct. Audiol Neurootol. 15(4): 247-53.
  • Size / Price
    Каталог: HG11368-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.