After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CNTN3 Информация о продукте «Клон cDNA»
Размер кДНК:3087bp
Описание кДНК:Full length Clone DNA of Homo sapiens contactin 3 (plasmacytoma associated) with N terminal Myc tag.
Синоним гена:CNTN3, PCS, PANG, BIG-1, KIAA1496
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10174-ACGRBS22240
Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10174-ACRRBS22240
Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10174-CFRBS20190
Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10174-CHRBS20190
Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10174-CMRBS20190
Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10174-CYRBS20190
Человек Contactin 3/CNTN3 Джин клон кДНК в вектор клонированияHG10174-MRBS5130
Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10174-NFRBS20190
Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10174-NHRBS20190
Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10174-NMRBS20190
Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10174-NYRBS20190
Человек Contactin 3/CNTN3 Джин ORF экспрессии кДНК клона плазмидыHG10174-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-3, also known as CNTN3 ( BIG-1 in rat and PANG in mouse ), is a GPI-linked glycoprotein that is expressed on cerebellar Purkinje cells, amygdaloid and thalamic neurons and olfactory granule cells. In the brain, Contactin-3 is expressed in frontal lobe, occipital lobe, cerebellum and amygdala. Contactin-3 contains 4 fibronectin type-III domains and 6 Ig-like C2-type (immunoglobulin-like) domains. Human Contactin-3 shares 92% aa identity with mouse Contactin-3.The exact function of Contactin-3 is unclear. Contactin-3 may mediate cell-cell interaction and may promote neurite outgrowth.

  • Yoshihara Y, et al. (1994) BIG-1: a new TAG-1/F3-related member of the immunoglobulin superfamily with neurite outgrowth-promoting activity. Neuron 13(2):415-26.
  • Yoshihara Y, et al. (1995) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. Journal of neurobiology 28(1):51-69.
  • Yoshihara Y, et al. (1995) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. Journal of neurobiology 28(1):51-69.
  • Shimoda Y, et al. (2009) Contactins: Emerging key roles in the development and function of the nervous system. Cell adhesion & migration 3(1):64-70.
  • Size / Price
    Каталог: HG10174-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.