Быстрый заказ

Text Size:AAA

Человек CNPY4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CNPY4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC032339
Размер кДНК:747bp
Описание кДНК:Full length Clone DNA of Homo sapiens canopy 4 homolog (zebrafish) with N terminal Flag tag.
Синоним гена:PRAT4B, CNPY4
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CNPY4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек CNPY4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13355-ACGRBS15396
Человек CNPY4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13355-ACRRBS15396
Человек CNPY4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13355-CFRBS13343
Человек CNPY4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13355-CHRBS13343
Человек CNPY4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13355-CMRBS13343
Человек CNPY4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13355-CYRBS13343
Человек CNPY4 Джин клон кДНК в вектор клонированияHG13355-GRBS5132
Человек CNPY4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13355-NFRBS13343
Человек CNPY4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13355-NHRBS13343
Человек CNPY4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13355-NMRBS13343
Человек CNPY4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13355-NYRBS13343
Человек CNPY4 Джин ORF экспрессии кДНК клона плазмидыHG13355-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CNPY4 belongs to the canopy family. CNPY4 interacts with toll-like receptor 4 (TLR4) and plays a role in the regulation of the cell surface expression of TLR4. Toll-like receptors (TLRs) recognize microbial products and induce immune responses. Lipopolysaccharide is recognized by the receptor complex consisting of TLR4 and MD-2. As CNPY4, PRAT4B also regulates cell surface expression of TLR4. PRAT4B has a signal peptide followed by a mature peptide. It is associated with the hypoglycosylated, immature form of TLR4 but not with MD-2 or TLR2.

Ссылки
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Hocking JC, et al. (2010) Distinct roles for Robo2 in the regulation of axon and dendrite growth by retinal ganglion cells. Mech Dev. 127(1-2):36-48.
  • Hart BE, et al. (2012) Cell surface trafficking of TLR1 is differentially regulated by the chaperones PRAT4A and PRAT4B. J Biol Chem. 287(20):16550-62.
  • Size / Price
    Каталог: HG13355-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».