Быстрый заказ

Человек CNGA4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CNGA4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC106936
    Размер кДНК:1728bp
    Описание кДНК:Full length Clone DNA of Homo sapiens cyclic nucleotide gated channel alpha 4 with C terminal His tag.
    Синоним гена:CNG4, CNG5, CNCA2, CNG-4, CNGB2, OCNC2, OCNCb, OCNCBETA
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CNGA4 qPCR primers for gene expression analysis, HP104337 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек CNGA4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек CNGA4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15744-ACGRBS16760
    Человек CNGA4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15744-ACRRBS16760
    Человек CNGA4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15744-CFRBS14710
    Человек CNGA4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15744-CHRBS14710
    Человек CNGA4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15744-CMRBS14710
    Человек CNGA4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15744-CYRBS14710
    Человек CNGA4 Джин клон кДНК в вектор клонированияHG15744-GRBS5130
    Человек CNGA4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15744-NFRBS14710
    Человек CNGA4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15744-NHRBS14710
    Человек CNGA4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15744-NMRBS14710
    Человек CNGA4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15744-NYRBS14710
    Человек CNGA4 Джин ORF экспрессии кДНК клона плазмидыHG15744-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15744-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».