UMP-CMP kinase / CMPK1 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

UMP-CMP kinase / CMPK1 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
687 bp
Description
Full length Clone DNA of Human cytidine monophosphate (UMP-CMP) kinase 1, cytosol with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

UMP-CMP kinase / CMPK1 cDNA ORF Clone, Human, N-His tag: Alternative Names

CK cDNA ORF Clone, Human; CMK cDNA ORF Clone, Human; CMPK cDNA ORF Clone, Human; UMK cDNA ORF Clone, Human; UMP-CMPK cDNA ORF Clone, Human; UMPK cDNA ORF Clone, Human

UMP-CMP kinase / CMPK1 Background Information

CMPK1 plays a key role in the maintenance of pyrimidine nucleotide pool profile and for the metabolism of pyrimidine analogs in cells. It catalyzes the phosphoryl transfer from ATP to UMP, CMP, and deoxy-CMP (dCMP), resulting in the formation of ADP and the corresponding nucleoside diphosphate. CMPK1 also has a significant role in the activation of pyrimidine analogs, which are clinically useful anti-cancer and anti-viral drugs. In the meanwhile, CMPK1 functions in cellular nucleic acid biosynthesis.
Full Name
cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
References
  • Liou J, et al. (2004) Phosphorylation of Cytidine, Deoxycytidine, and Their Analog Monophosphates by Human UMP/CMP Kinase is Differentially Regulated by ATP and Magnesium. Molecular Pharmacology. 67(3):806-14.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC). Genome Research. 14(10B):2121-7.
  • Segura-Pena D, et al. (2004) Substrate-induced Conformational Changes in Human UMP/CMP Kinase. Journal of Biological Chemistry. 279(32):33882-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait