Быстрый заказ

Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CMPK1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC014961
    Размер кДНК:687bp
    Описание кДНК:Full length Clone DNA of Homo sapiens cytidine monophosphate (UMP-CMP) kinase 1, cytosol.
    Синоним гена:RP11-511I2.1, CMK, CMPK, UMK, UMP-CMPK, UMPK, CMPK1
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CMPK1 qPCR primers for gene expression analysis, HP102908 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14258-ACGRBS15400
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14258-ACRRBS15400
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14258-ANGRBS15400
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14258-ANRRBS15400
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14258-CFRBS13340
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14258-CHRBS13340
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14258-CMRBS13340
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14258-CYRBS13340
    Человек CMPK1 Джин клон кДНК в вектор клонированияHG14258-GRBS5130
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14258-NFRBS13340
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14258-NHRBS13340
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14258-NMRBS13340
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14258-NYRBS13340
    Человек CMPK1 Джин ORF экспрессии кДНК клона плазмидыHG14258-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    CMPK1 plays a key role in the maintenance of pyrimidine nucleotide pool profile and for the metabolism of pyrimidine analogs in cells. It catalyzes the phosphoryl transfer from ATP to UMP, CMP, and deoxy-CMP (dCMP), resulting in the formation of ADP and the corresponding nucleoside diphosphate. CMPK1 also has a significant role in the activation of pyrimidine analogs, which are clinically useful anti-cancer and anti-viral drugs. In the meanwhile, CMPK1 functions in cellular nucleic acid biosynthesis.

    Ссылки
  • Liou J, et al. (2004) Phosphorylation of Cytidine, Deoxycytidine, and Their Analog Monophosphates by Human UMP/CMP Kinase is Differentially Regulated by ATP and Magnesium. Molecular Pharmacology. 67(3):806-14.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC). Genome Research. 14(10B):2121-7.
  • Segura-Pena D, et al. (2004) Substrate-induced Conformational Changes in Human UMP/CMP Kinase. Journal of Biological Chemistry. 279(32):33882-9.
  • Size / Price
    Каталог: HG14258-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».