After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CMPK1 Информация о продукте «Клон cDNA»
Размер кДНК:687bp
Описание кДНК:Full length Clone DNA of Homo sapiens cytidine monophosphate (UMP-CMP) kinase 1, cytosol with N terminal His tag.
Синоним гена:RP11-511I2.1, CMK, CMPK, UMK, UMP-CMPK, UMPK, CMPK1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14258-ACGRBS15400
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14258-ACRRBS15400
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14258-ANGRBS15400
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14258-ANRRBS15400
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14258-CFRBS13340
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14258-CHRBS13340
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14258-CMRBS13340
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14258-CYRBS13340
Человек CMPK1 Джин клон кДНК в вектор клонированияHG14258-GRBS5130
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14258-NFRBS13340
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14258-NHRBS13340
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14258-NMRBS13340
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14258-NYRBS13340
Человек CMPK1 Джин ORF экспрессии кДНК клона плазмидыHG14258-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CMPK1 plays a key role in the maintenance of pyrimidine nucleotide pool profile and for the metabolism of pyrimidine analogs in cells. It catalyzes the phosphoryl transfer from ATP to UMP, CMP, and deoxy-CMP (dCMP), resulting in the formation of ADP and the corresponding nucleoside diphosphate. CMPK1 also has a significant role in the activation of pyrimidine analogs, which are clinically useful anti-cancer and anti-viral drugs. In the meanwhile, CMPK1 functions in cellular nucleic acid biosynthesis.

  • Liou J, et al. (2004) Phosphorylation of Cytidine, Deoxycytidine, and Their Analog Monophosphates by Human UMP/CMP Kinase is Differentially Regulated by ATP and Magnesium. Molecular Pharmacology. 67(3):806-14.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC). Genome Research. 14(10B):2121-7.
  • Segura-Pena D, et al. (2004) Substrate-induced Conformational Changes in Human UMP/CMP Kinase. Journal of Biological Chemistry. 279(32):33882-9.
  • Size / Price
    Каталог: HG14258-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.