After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CMC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC052644
Размер кДНК:321bp
Описание кДНК:Full length Clone DNA of Homo sapiens COX assembly mitochondrial protein 1 homolog (S. cerevisiae) DNA.
Синоним гена:C3orf68
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15212-ACGRBS15400
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15212-ACRRBS15400
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15212-ANGRBS15400
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15212-ANRRBS15400
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15212-CFRBS13340
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15212-CHRBS13340
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15212-CMRBS13340
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15212-CYRBS13340
Человек CMC1 Джин клон кДНК в вектор клонированияHG15212-GRBS5130
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15212-NFRBS13340
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15212-NHRBS13340
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15212-NMRBS13340
Человек CMC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15212-NYRBS13340
Человек CMC1 Джин ORF экспрессии кДНК клона плазмидыHG15212-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15212-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».