Быстрый заказ

Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CLMP Информация о продукте «Клон cDNA»
Размер кДНК:1122bp
Описание кДНК:Full length Clone DNA of Homo sapiens adipocyte-specific adhesion molecule with N terminal Myc tag.
Синоним гена:ASAM, ACAM, CLMP, FLJ22415
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10794-ACGRBS15400
Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10794-ACRRBS15400
Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10794-CFRBS13340
Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10794-CHRBS13340
Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10794-CMRBS13340
Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10794-CYRBS13340
Человек ASAM / CLMP Джин клон кДНК в вектор клонированияHG10794-MRBS5130
Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10794-M-FRBS13340
Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10794-NFRBS13340
Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10794-NHRBS13340
Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10794-NMRBS13340
Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10794-NYRBS13340
Человек ASAM / CLMP Джин ORF экспрессии кДНК клона плазмидыHG10794-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Adipocyte-specific adhesion molecule (ASAM), also known as ACAM and CLMP, is a type I transmembrane protein and a member of the CTX (cortical thymocyte marker in Xenopus) family within the immunoglobulin superfamily. ASAM protein is highly expressed in the small intestine and placenta, and is found at intermediate levels in the heart, skeletal muscle, colon, spleen, kidney, and lung, and appears in low levels in the liver and peripheral blood leukocytes as well. ASAM is a transmembrane component of tight junctions in epithelial cells that can mediate cell aggregation and regulate transepithelial resistance across polarized epithelial cells. In addition, its expression is strongly correlated with white adipose tissue (WAT) mass of human and rodents with obesity.

  • Eguchi J, et al. (2005) Identification of adipocyte adhesion molecule (ACAM), a novel CTX gene family, implicated in adipocyte maturation and development of obesity. Biochem J. 387(Pt 2): 343-53.
  • Sze KL, et al. (2008) Expression of CLMP, a novel tight junction protein, is mediated via the interaction of GATA with the Kruppel family proteins, KLF4 and Sp1, in mouse TM4 Sertoli cells. J Cell Physiol. 214(2): 334-44.
  • Sze KL, et al. (2008) Post-transcriptional regulation of CLMP mRNA is controlled by tristetraprolin in response to TNFalpha via c-Jun N-terminal kinase signalling. Biochem J. 410(3): 575-83.
  • Size / Price
    Каталог: HG10794-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.