After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CLIC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC064527
Размер кДНК:726bp
Описание кДНК:Full length Clone DNA of Homo sapiens chloride intracellular channel 1 DNA.
Синоним гена:G6, NCC27
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15242-ACGRBS15396
Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15242-ACRRBS15396
Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15242-CFRBS13343
Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15242-CHRBS13343
Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15242-CMRBS13343
Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15242-CYRBS13343
Человек CLIC1/NCC27 Джин клон кДНК в вектор клонированияHG15242-GRBS5132
Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15242-NFRBS13343
Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15242-NHRBS13343
Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15242-NMRBS13343
Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15242-NYRBS13343
Человек CLIC1/NCC27 Джин ORF экспрессии кДНК клона плазмидыHG15242-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15242-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».