After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CLEC4M Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_014257.3
Размер кДНК:1200bp
Описание кДНК:Full length Clone DNA of Homo sapiens C-type lectin domain family 4, member M with N terminal Flag tag.
Синоним гена:CD299, LSIGN, CD209L, L-SIGN, DCSIGNR, HP10347, DC-SIGN2, DC-SIGNR, MGC47866, MGC129964
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10559-ACGRBS15400
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10559-ACRRBS15400
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10559-CFRBS13340
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10559-CHRBS13340
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10559-CMRBS13340
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10559-CYRBS13340
Человек DC-SIGNR/CD299 Джин клон кДНК в вектор клонированияHG10559-MRBS5130
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10559-M-FRBS13340
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмидыHG10559-M-NRBS13340
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10559-NFRBS13340
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10559-NHRBS13340
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10559-NMRBS13340
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10559-NYRBS13340
Человек DC-SIGNR/CD299 Джин ORF экспрессии кДНК клона плазмидыHG10559-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

C-type lectin domain family 4, member M, also known as DC-SIGNR and CLEC4M, is a type II integral membrane protein that is 77% amino acid identical to DC-SIGN, an HIV gp120-binding protein. Though the encoded gene located in the same chromosome, DC-SIGN is expressed solely on dendritic cells, while DC-SIGNR is predominantly found in liver sinusoidal endothelial cells and lymph node, as well as placental endothelium. DC-SIGNR exists as a homotetramer, and the tandem repeat domain, also called neck domain, mediates oligermerization. DC-SIGNR is ragarded as a pathogen-recognition receptor involved in peripheral immune surveillance in liver, and probably mediate the endocytosis of pathogens which are subsequently degraded in lysosomal compartments. DC-SIGNR appears to selectively recognize and bind many viral surface glycoproteins containing high mannose N-linked oligosaccharides in a calcium-dependent manner, including HIV-1 gp120, HIV-2 gp120, SIV gp120, ebolavirus glycoproteins, HCV E2, and human SARS coronavirus protein S, as well as the cellular adhesion protein ICAM3. DC-SIGNR have been thought to play an important role in establishing HIV infection by enhancing trans-infection of CD4(+)T cells in the regional lymph nodes. It may affect susceptibility to HIV infection by a mechanism that is different in females and males. DC-SIGNR can bind to hepatitis C virus (HCV), and its polymorphism might affect HCV loads supporting the concept that DC-SIGNR contributes to HCV replication efficacy.

Ссылки
  • Nattermann J, et al. (2006) The tandem-repeat polymorphism of the DC-SIGNR gene in HCV infection. J Viral Hepat. 13(1): 42-6.
  • Wichukchinda N, et al. (2007) The polymorphisms in DC-SIGNR affect susceptibility to HIV type 1 infection. AIDS Res Hum Retroviruses. 23(5): 686-92.
  • Size / Price
    Каталог: HG10559-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».