Быстрый заказ

Text Size:AAA

Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CLEC3B Информация о продукте «Клон cDNA»
Размер кДНК:609bp
Описание кДНК:Full length Clone DNA of Homo sapiens C-type lectin domain family 3, member B with N terminal His tag.
Синоним гена:TN, TNA, DKFZp686H17246, CLEC3B
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12735-ACGRBS15400
Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12735-ACRRBS15400
Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12735-CFRBS13340
Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12735-CHRBS13340
Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12735-CMRBS13340
Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12735-CYRBS13340
Человек Tetranectin/CLEC3B Джин клон кДНК в вектор клонированияHG12735-MRBS5130
Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12735-NFRBS13340
Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12735-NHRBS13340
Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12735-NMRBS13340
Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12735-NYRBS13340
Человек Tetranectin/CLEC3B Джин ORF экспрессии кДНК клона плазмидыHG12735-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tetranectin (TN), also known as C-type lectin domain family 3, member B (CLEC3B) is a member of the C-type lectin Family. It is plasminogen kringle 4 binding protein and regulates fibrinolysis and proteolytic processes via binding to plasminogen. Tetranectin has been suggested to play a role in tissue remodeling, due to its ability to stimulate plasminogen activation and its expression in developing tissues such as developing bone and muscle. Tetranectin enhances plasminogen activation by a tissue-type plasminogen activator so that it has been suggested to play a role in tissue remodeling. Tetranectin may play a role in the wound healing process. Tetranectin may play a role in neurological diseases and may serve as a diagnostic aid in multiple sclerosis (MS). Tetranectin was found significantly under-expressed in both serum and saliva of metastatic oral squamous cell carcinoma (OSCC) compared to primary OSCC. Tetranectin is thought to enhance proteolytic processes enabling tumor cells to invade and metastasize.

  • Iba K, et al. (2001) Mice with a targeted deletion of the tetranectin gene exhibit a spinal deformity. Mol Cell Biol. 21(22): 7817-25.
  • Stoevring B, et al. (2006) Tetranectin in cerebrospinal fluid of patients with multiple sclerosis. Scand J Clin Lab Invest. 66(7): 577-83.
  • Brunner A, et al. (2007) Expression and prognostic significance of Tetranectin in invasive and non-invasive bladder cancer. Virchows Arch. 450(6): 659-64.
  • Iba K, et al. (2009) Impaired cutaneous wound healing in mice lacking tetranectin. Wound Repair Regen. 17(1): 108-12.
  • Arellano-Garcia ME, et al. (2010) Identification of tetranectin as a potential biomarker for metastatic oral cancer. Int J Mol Sci. 11(9): 3106-21.
  • Wang L, et al. (2010) Tetranectin is a potential biomarker in cerebrospinal fluid and serum of patients with epilepsy. Clin Chim Acta. 411(7-8): 581-3.
  • Size / Price
    Каталог: HG12735-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.