Быстрый заказ

Text Size:AAA

Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CLEC1B Информация о продукте «Клон cDNA»
Размер кДНК:690bp
Описание кДНК:Full length Clone DNA of Homo sapiens C-type lectin domain family 1, member B with C terminal Flag tag.
Синоним гена:CLEC2, CLEC2B, PRO1384, QDED721, 1810061I13Rik
Участок рестрикции:KpnI + XbaI (6kb + 0.73kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CLEC1B Gene Plasmid Map
Human CLEC1B natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10976-ACGRBS15396
Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10976-ACRRBS15396
Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10976-CFRBS13343
Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10976-CHRBS13340
Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10976-CMRBS13343
Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10976-CYRBS13343
Человек CLEC1B/CLEC2 Джин клон кДНК в вектор клонированияHG10976-MRBS5132
Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10976-NFRBS13343
Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10976-NHRBS13343
Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10976-NMRBS13343
Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10976-NYRBS13343
Человек CLEC1B/CLEC2 Джин ORF экспрессии кДНК клона плазмидыHG10976-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CLEC1B, also known as CLEC2, is a C-type lectin-like receptor expressed in myeloid cells and NK cells. Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 and NKG2D, that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 acts as a receptor for the platelet-aggregating snake venom protein rhodocytin. Rhodocytin binding leads to tyrosine phosphorylation and this promotes the binding of spleen tyrosine kinase (Syk) and initiation of downstream tyrosine phosphorylation events and activation of PLC-gamma-2. CLEC2 contains 1 C-type lectin domain and is expressed preferentially in the liver. It acts as an attachment factor for human immunodeficiency virus type 1 (HIV-1) and facilitates its capture by platelets.

  • Suzuki-Inoue K, et al. (2007) Involvement of the snake toxin receptor CLEC-2, in podoplanin-mediated platelet activation, by cancer cells. J Biol Chem. 282(36):25993-6001.
  • Watson AA, et al. (2007) The crystal structure and mutational binding analysis of the extracellular domain of the platelet-activating receptor CLEC-2. J Biol Chem. 282(5):3165-72.
  • Chaipan C, et al. (2006) DC-SIGN and CLEC-2 mediate human immunodeficiency virus type 1 capture by platelets. J Virol. 80(18):8951-60.
  • Size / Price
    Каталог: HG10976-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human COL10A1 ORF mammalian expression plasmid, C-Flag tag
    • Human CLEC1B natural ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.