CKMT2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14453-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CKMT2 Reagents

CRO Services

Product recommended


All CKMT2 Reagents

CKMT2 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1260 bp
Description
Full length Clone DNA of Human creatine kinase, mitochondrial 2 (sarcomeric) with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CKMT2 cDNA ORF Clone, Human, C-Myc tag Alternative Names

SMTCK cDNA ORF Clone, Human

CKMT2 Background Information

Full Name
creatine kinase, mitochondrial 2 (sarcomeric)

CKMT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CKMT2 cDNA ORF Clone in Cloning Vector, Rat RG80619-U
CKMT2 cDNA ORF Clone, Rat, untagged RG80619-UT
CKMT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80619-ACGLN
CKMT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80619-ACG
CKMT2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80619-ANG
CKMT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80619-ACR
CKMT2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80619-ANR
CKMT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80619-CF
CKMT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80619-NF
CKMT2 cDNA ORF Clone, Rat, C-His tag RG80619-CH
CKMT2 cDNA ORF Clone, Rat, N-His tag RG80619-NH
CKMT2 cDNA ORF Clone, Rat, C-HA tag RG80619-CY
CKMT2 cDNA ORF Clone, Rat, N-HA tag RG80619-NY
CKMT2 cDNA ORF Clone, Rat, C-Myc tag RG80619-CM
CKMT2 cDNA ORF Clone, Rat, N-Myc tag RG80619-NM
CKMT2 qPCR Primer Pairs, Rat RP300583

CKMT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CKMT2 cDNA ORF Clone in Cloning Vector, Mouse MG53058-G
CKMT2 cDNA ORF Clone, Mouse, untagged MG53058-UT
CKMT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53058-ACGLN
CKMT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53058-ACG
CKMT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53058-ACR
CKMT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53058-CF
CKMT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53058-NF
CKMT2 cDNA ORF Clone, Mouse, C-His tag MG53058-CH
CKMT2 cDNA ORF Clone, Mouse, N-His tag MG53058-NH
CKMT2 cDNA ORF Clone, Mouse, C-HA tag MG53058-CY
CKMT2 cDNA ORF Clone, Mouse, N-HA tag MG53058-NY
CKMT2 cDNA ORF Clone, Mouse, C-Myc tag MG53058-CM
CKMT2 cDNA ORF Clone, Mouse, N-Myc tag MG53058-NM

CKMT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CKMT2 cDNA ORF Clone in Cloning Vector, Human HG14453-G
CKMT2 cDNA ORF Clone, Human, untagged HG14453-UT
CKMT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14453-ACG
CKMT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14453-ACGLN
CKMT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14453-ANG
CKMT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14453-ACR
CKMT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14453-ANR
CKMT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14453-CF
CKMT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14453-NF
CKMT2 cDNA ORF Clone, Human, C-His tag HG14453-CH
CKMT2 cDNA ORF Clone, Human, N-His tag HG14453-NH
CKMT2 cDNA ORF Clone, Human, C-HA tag HG14453-CY
CKMT2 cDNA ORF Clone, Human, N-HA tag HG14453-NY
CKMT2 cDNA ORF Clone, Human, N-Myc tag HG14453-NM
CKMT2 qPCR Primer Pairs, Human HP103101
info info
添加购物车成功! 添加购物车失败!