Быстрый заказ

Text Size:AAA

Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CKMT1A Информация о продукте «Клон cDNA»
Размер кДНК:1254bp
Описание кДНК:Full length Clone DNA of Homo sapiens creatine kinase, mitochondrial 1A with C terminal Flag tag.
Синоним гена:CKMT1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13924-ACGRBS15396
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13924-ACRRBS15396
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13924-ANGRBS15396
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13924-ANRRBS15396
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13924-CFRBS13343
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13924-CHRBS13343
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13924-CMRBS13343
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13924-CYRBS13343
Человек CKMT1A Джин клон кДНК в вектор клонированияHG13924-GRBS5132
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13924-NFRBS13343
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13924-NHRBS13343
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13924-NMRBS13343
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13924-NYRBS13343
Человек CKMT1A Джин ORF экспрессии кДНК клона плазмидыHG13924-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CKMT1A belongs to the ATP:guanido phosphotransferase family. It contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. CKMT1A gene is one of two genes which encode the ubiquitous mitochondrial creatine kinase (CKMT1). CKMT1 is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK (CKMT2) and ubiquitous MtCK, encoded by separate genes. CKMT1 occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Ubiquitous mitochondrial creatine kinase has 80% homology with the coding exons of sarcomeric CKMT1.

  • Haas RC, et al. (1989) Isolation and characterization of the gene and cDNA encoding human mitochondrial creatine kinase. J Biol Chem. 264(5):2890-7.
  • Stachowiak O, et al. (1998) Oligomeric state and membrane binding behaviour of creatine kinase isoenzymes: implications for cellular function and mitochondrial structure. Mol Cell Biochem. 184(1-2):141-51.
  • Lipskaya TY. (2001) Mitochondrial creatine kinase: properties and function. Biochemistry Mosc. 66(10):1098-111.
  • Size / Price
    Каталог: HG13924-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.